Sequencing with 5' and 3' end vector arm primers of pLexA confirmed that the reading frame of insert HERPUD 1 was correct and there was no base mutation.

1.2.2 amplification of human fetal brain library and extraction of plasmid DNA; Construction of cDNA library of human fetal brain matcher in pB42AD plasmid vector 17 repair date: 2005; QIAGEN plasmid Mega kit was purchased from QIAGEN Company.

Neurology; Neuron; Keratin; Interaction; Yeast two-hybrid Herp

Bax inhibitor? α. 1 bait plasmid pLexA? Construction of HERPUD 1 The coding region of HERPUD 1 was amplified by PCR, and the forward and reverse primers were 5' respectively, which was self-activating. Polyphenol oligosaccharide phosphate and other substances, low melting point fingerprint agarose were collected in conical flask. ? Bax inhibitor in Trp medium? 1 Interaction with Herp

China Biotechnology, China Biotechnology, exploring the regulatory mechanism of the gene HERPUD 1 encoding the protein, providing the basis for studying the molecular mechanism of NCLs, 2005.38+0 materials.

The LexA cDNA library of fetal brain matchmaker was used, and then Herp and the screened interacting proteins were returned one-to-one for yeast two-hybrid experiment. There are biochemical abnormalities of lysosomal hydrolase in cells, so remove false positives? Ura/. Add 10ml LB culture solution to each dish, scrape off the colonies and spread them on SD/? 1

When the manuscript is received, the colony is blue, otherwise it is white.

1. 2. 4 bait plasmid +EGY48(p8op, mitochondrial ATPase C subunit, significantly deposited in polymorphic NCLs? Trp/, including metals and protein [2]. According to the defect of lysosomal protease gene and the dysfunction of structural protein [3], this group of neurodegenerative diseases is considered as a new lysosomal lipofuscin deposition disease.

1，EGY48(p8op？ LacZ), HERPUD 1 gene sequence was proposed by Dr. Nanbert Zhong, Institute of Developmental Dysplasia, New York, USA. Results The intron sequence of 1 positive clone was consistent with the sequence of TEGT gene, and it had progressive mental retardation, X? Ura. Sequencing the DNA sequences of the inserted fragments of positive clones, comparing them in GenBank, and conducting bioinformatics analysis. Is the encoded protein a Bax inhibitor? 1。 Draw a conclusion, 25( 1 1)? 3′, 5′? GGTGAATTCGTT

TGCGATGGCTGGGGGGCCTTC？ Isolation of 3'6 positive cloning plasmid; The positive yeast cloning plasmid was extracted and transformed into Escherichia coli kc8. At present, six pathogenic genes (CLN 1~3? Leu medium, x? α? Gal and others were purchased from Clontech company; Amp+/Trp？ Screening and separating on the culture medium to obtain the target plasmid.

1.2.7 Reconstruct the relationship between Herp and interacting proteins, exclude false positives, and reconstruct the combination of four positive and negative controls according to the interaction: (1)pLexA? HERPUD 1+pB42AD？ y； (2)pB42AD？ Y self-activation test: pLexA+pB42AD? y； (3) pLexA？ Pos+ pB42AD？ t； (4) Interactive negative control pLexA? Lam+pB42AD. preliminarily verified the interaction, and sequenced the blue again.

1.2.8 DNA sequencing and bioinformatics analysis of interacting protein gene y The 5' and 3' ends of pB42AD were sequenced with vector arm primers, and the interaction of pB42AD was still positive. Y sequencing, the sequencing results were analyzed by BLAST with NCBI GenBank, EMBL and other biological information databases on the Internet, and the possible reading frames were analyzed by GCG software.

2. Verification of results of1bait plasmid

pLexA？ HERPUD 1 transformed E.coli DH5α, then extracted the plasmid and amplified it by PCR to obtain a 925bp band (Figure 1), which was also produced by EcoRI digestion (Figure 2).

Figure 1pLexA? Electrophoresis of HERPUD 1 PCR products

Fig.1electrophoresis map of PCR products

Praxair's? Hepude 1

1:PCR product; M: 200bp DNA ladder DNA marker

Figure 2pLexA? Electrophoresis of HERPUD 1 product digested by EcoRI.

Fig. 2 Electrophoresis spectrum of the product

pLexA？ Herpud/EcoRI-0/

M:λDNA/eco ri+Hindi ii labeling; 1: pLexA？ herpud 1；

2:pLexA； 3: Praxair products? HERPUD 1 digested by EcoRI

pLexA？ The sequencing results of HERPUD 1 confirmed that the inserted fragment of the bait plasmid had no mutation and the reading frame was correct. The sequencing results are shown in Figure 3.

2.2 DNA sequencing and bioinformatics analysis of positive clones

The clone of 1 interacting protein with positive expression of Leu and Lacz was sequenced, and a 680bp sequence was obtained by sequencing (Figure 4). BLAST analysis in GenBank found that the sequence was consistent with TEGG gene, and the reading frame of the coding region was correct by GCG software analysis. Is the protein encoded by TEGG gene a Bax inhibitor? 1, Bioinformatics Analysis of Bax Inhibitors? 1 is a gene-enhanced transcription factor, similar to BCL2 and BCL? X interaction regulates apoptosis. Figure 3pLexA? Partial sequence of HERPUD 1 fusion plasmid

Fig. 3 Partial sequence of Plexa? HERPUD 1 fusion plasmid

Partial sequencing results of intron DNA of a positive cloning plasmid were screened from human fetal brain cDNA library.

Fig. 4 Partial sequencing results of a positive clone screened from human fetal cDNA library.

Conclusion NCLs is a group of fatal diseases, and there is no effective treatment at present. Understanding the function of CLN gene and its coding protein is of great significance to clarify the molecular mechanism of pathology, heredity and pathogenesis. At present, it is known that NCLs is caused by mutations of at least eight different genes (CLN 1 ~ 8). The pathogenic gene of juvenile type (JNCL, NCL3) is CLN3. Battenin, a protein encoded by CLN3, is located on the membrane of lysosomes, and it is an essential membrane glycoprotein of lysosomes. It participates in the regulation of the pH of lysosomes in mammalian cells and has neurotrophic effects [1 1]. Herp is the interaction of Battenin. Protein, Sai et al [12] found that Herp interacts with presenilin to increase amyloid β protein (amyloid β? Protein's degeneration (Abeta) shows that Herp is related to cell growth and development, so it is of great significance to study the function of Herp to clarify the pathogenesis of NCLs.

Many biochemical reactions and metabolic processes in the body have the interaction between protein and protein, and the interaction between protein plays an extremely important role in the process of life. In this study, a protein interacting with Herp-Bax inhibitor was screened by yeast two-hybrid system. 1, which was found to be a new Herp interacting protein after completely consulting the interacting protein database and DIP. Chae et al. [13] found Bax inhibitors? 1 regulates the apoptosis pathway related to endoplasmic reticulum stress. In endoplasmic reticulum-induced apoptosis, it protects and stabilizes mitochondrial membrane voltage and inhibits Caspase activation by inhibiting Bax activation and mitochondrial translocation. Bax inhibitor? 1 is an evolutionarily conserved endoplasmic reticulum protein and an apoptosis regulator, which is associated with BCL2(B-cell lymphoma/leukemia? 2) and BCL? X (B-cell lymphoma/leukemia? X) interaction, BCL2 and BCL? These two genes are apoptosis-related genes, and Herp can interact with Bax inhibitors? 1 interaction suggests that Herp is related to apoptosis regulation. NCLs is a neurodegenerative disease. Herp, Bax inhibitor? 1、BCL2、BCL？ X promotes the apoptosis or death of nerve cells through mutual coordination or antagonism in the pathogenesis of NCLs, but the specific mechanisms such as gene expression regulation network, changes in cell signal transduction pathway and specific changes in cell ions need to be further explored. refer to

[1] Wisniewski K. E, Kida E, Connell F, et al. Neuronal ceroid lipofuscosis: research progress. Neuroscience, 2000,21(supplement): 49~56

[2] Prasal V V, Pullarkat R K. Brain lysosomal hydrolase in neuronal lipofuscosis. Molecular chemical neuropathology,1996,29 (2? 3): 169~ 179

Mole s, Zhong N, Sarpong A, et al. New mutation of neuron lipofuscosis gene. European Journal of Pediatric Neurology, 200 1.5 (supplement): 7~ 10.

[4] Goebel H. Neuronal waxy lipofuscosis. Pediatric neurology, 1995, 10:424~437.

[5] Mole S.E. Genetic spectrum of waxy lipofuscin-like substances in human neurons. Brain Pathology, 2004, 14( 1):70~76

Sohar I, Sleat D E, Jadot M, et al. Biochemical characteristics and enzyme development of lysosomal protease lacking in classical late infant neurons lipofuscin (LINCL)? Basic analysis for diagnosing and excluding LINCL in human specimens and animal models. Journal of Neurochemistry, 1997, 73:700~7 1 1

Ranta s, Savukoski M, Santavuori P, etc. Studies on Homogeneous Groups: CLN5 and CLN8. Adv Genet，200 1，45: 123~ 140

Zhong Ning, Zhu Wei, Moroz Wiz Ding Ning, et al. Study on the Molecular Pathogen of Pasteurellosis: Identification and Characteristics of Pasteurectin? Interaction protein (Herp). J Mol Diag， 1999， 1( 1):G23

Zhong Ning, Zhu Wei, Moroziewicz D, et al. Prenatal diagnostic test (ASPE) of neuronal waxy fatty fusion (NCL) in infants and late infants by allele-specific primer extension. Journal of Peking University (Health Science Edition), 2005,37 (1): 20 ~ 25.

[10] Zhong Ning, Zhu Wei, Morozzi Yevich, et al. Interaction protein (BIP) may be helpful to understand the pathogenesis of neuronal lipofuscosis. Genetic medicine, 200 1, 3(3): 140

[11] Puranam K L, Guo Weixin, Qian Weihong, et al. CLN3 defines a new anti-apoptosis pathway which plays a role in neurodegeneration and is mediated by ceramide. Molecular genetic metabolism,1999,66: 294 ~ 308.

[12] Sai X, Kokame K, Baishi H, et al. Ubiquitin? Like domain of Herp is involved in the degradation of Herp, but it is not necessary for the enhancement of amyloid β protein? Protein generation. FEBS Lite, 2003,553 (1? 2): 15 1~ 156

[13] Cai Haizhen, Jin Hairui, Xu Chun, etc. 1 regulates the apoptosis pathway related to endoplasmic reticulum stress. Molar cell, 2004, 15(3):355~366

Screening and bioinformatics analysis of proteins interacting with Herp

Li Bin? Yuan 1 He Shu? Ya 1 Wang Gui? Liang 1MA yun 1x Xiaowei? chun 1

Li Jie 1 Sun Chun? Li 1MIN ling? Feng 1 Yujia 1 Nanbotong 2

(1 Department of Biochemistry and Molecular Biology, University of South China, Hengyang 42 100 1, China)

(2 Department of Human Genetics, new york State Institute of Basic Studies, new york 103 14)

Objective to screen the interacting proteins of Herp by yeast two-hybrid system. The eukaryotic expression vector pLexA HerpUD 1 was constructed, and the human fetal cDNA library was screened by MATCHMAKER LexA. The inserted fragments of positive clones were used as candidate interacting proteins of HERP. The yeast two-hybrid was repeated to screen protein and remove false positive clones. A positive insert was consistent with TEGT sequence encoding Bax inhibitor. 1.Herp interacts with Bax inhibitors? 1 has the characteristics of regulating apoptosis, suggesting that Herp is involved in the regulation of apoptosis.

Keywords neural waxy lipofuscin protein interaction yeast two-hybrid system? 1。 Cultured at 37℃ for 12h, the library titer was calculated according to the clone growth number, 25( 1 1) Li et al.: Bax inhibitor? 1 Interaction with Herp

Biotechnology in China and Biotechnology in China, Volume 25,No. 1 1 2005.

1。

1 materials and methods 1, HERPUD 1 were inserted into pLexA? HTU+X？ LacZ) establishment of fusion strain bait plasmid pLexA? HERPUD 1 Complete transformation of EGY48(p8op? LacZ) standby.

February 2005, matchmaker LexA yeast two-hybrid system, yeast SD medium, SD/, SD/, 5: 2005? 05, Mailbox :skyhe2000@hotmail.com Neurolipofuscin Deposition (other chemical reagents are purchased in China). The sequencing company is Shanghai Gong Sheng Bioengineering Technology Service Co., Ltd. ..

1.2 method

1: HERP and Bax inhibitors? 1 interaction, Bax inhibitor? 1 has the characteristics of regulating apoptosis, suggesting that Herp may be involved in the regulation of apoptosis; Kc8 Escherichia coli, bait plasmid (pLexA? HERPUD 1) and pB42AD*** to EGY48(p8op? LacZ), laid in SD; ? Ura/ Battenin exists in lysosomes and mitochondria, and its function is not clear. Zhong et al [8 ~ 10] found that Herp can interact with Battenin, and the number of independent clones (cfu) in the library was 3.5× 106. According to the titer and the number of independent clones, the volume of the original bacterial solution and the number of plates of the required library were calculated. The liquid culture solution (Amp+) diluted the original bacterial solution of the library, spread it on 150mm LB plate (Amp+), 80 plate * * *, SD/, and used the coding sequence of the gene HERPUD 1 as bait? 07? 22

* National Natural Science Foundation Project (30370795)

* * Correspondent, whose main features are dyskinesia and behavior change [1], SD/, ncls) is a group of human progressive neurodegenerative diseases; ? Leu/Raf/Gal, cultured for 4 ~ 6 days, 8), caused NCL 1~3, 5, 6, 8 [4, 5] diseases respectively; ? Ura/His, SD/, in M9/.2, the main function is unclear, and lithium acetate is purchased from Sigma Company. ? his/； ? Ura/His？ Trp/, bending, is mostly autosomal recessive inheritance. Clinical manifestations are rapid deterioration of vision and seizures; ? His? Trp. the plasmid was extracted with QIANGEN Plasmid Mega Kit and stored at -20℃ for later use.

1.2.3 The toxicity and self-activation of bait plasmid were detected by small-scale transformation, linear and mixed deposition, which led to the apoptosis of nerve cells and retinal cells. NCLs can be divided into at least 10 disease subtypes. * * * The main pathological feature is that the waxy lipofuscin in lysosomes is granular; ? Transformation and screening of yeast Ura/.5 library preparation (pLexA transformed? HERPUD 1 expression plasmid) and transferred into library plasmid by lithium acetate method; ? His? Trp, cultured for 4 ~ 6 days. The scraped bacterial liquid was coated on SD/, 6 and 2. In addition, the deposited lipofuscin also contains phospholipids and neutral lipids. Battenin protein encoded by CLN3 is considered as a transmembrane protein [6]. Protein interacting with Herp was screened from human fetal brain cDNA library, and the function of Herp was studied. Herp is a ubiquitin-like domain building block protein 1, which is located in the homocysteine reaction of endoplasmic reticulum. The gene encoding this protein is HERPUD 1? Gal culture dish, inverted culture at 30℃ for 4 ~ 6 days. If the bait is poisonous, no colonies will grow? TTCGAATTC

ATGGAGTCCGAGACCGAACC .

In this study, the matchmaker LexA two-hybrid system (matchmaker LexA two? Hybrid system). 2； Galactose (Gal), raffinose (Raf), HERPUD 1 insertion t vector, t? HERPUD 1 and pLexA were digested with EcoRI respectively. Gal filtration analysis showed that the clones that turned blue were initially considered as positive clones (set to pB42AD? Y): 16~20

Li 1 He 1** Wang Guiliang 1 Ma Yun 1 Xiao Weichun 1 Li Jie 1.

Sun Chunli 1 Min Lingfeng 1 Yu Jia 1 South Bert Middle School 2

(1 Laboratory of Biochemistry and Molecular Biology, University of South China Hengyang 42 100 12 Laboratory of Human Genetics, new york State Basic Research Institute, new york NY 103 14)

Screening of Herp interacting proteins by yeast two-hybrid technique. Construction of eukaryotic expression vector HerpUD 1 encoding HERP? The cDNA library of human fetal brain was screened by MATCHMAKER LexA yeast two-hybrid system, and the inserter of the positive clone was the candidate interacting protein of Herp.